| Internal ID | 18106929 | Source Database | TransTermHP TERM 310 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 310
|
| Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
| Start | 1220333 |
| End | 1220357 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA044 adkfY-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGAGATGGAACGAA(5' tail) GAACCCCGGC(5' stem) CATGA(loop) GCCGGGGTTC(3' stem) TTCGTTCCTGATTGC(3' tail). Confidence: 100. opp_overlap 1220329 1220333 1220336, overlap 1220329 1220325 1220336 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|