Internal ID | 18102820 | Source Database | TransTermHP TERM 299 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 299
|
Sequence |
CCCGCGTACCCGCAAGGGACGCGGG Look for more occurrences |
Start | 1079831 |
End | 1079855 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BWHPSA041 adkgd-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGTCGAGGCAGAGG(5' tail) CCCGCGTACCC(5' stem) GCAA(loop) GGG-ACGCGGG(3' stem) TTTTTTCATGCCCGG(3' tail). Confidence: 100. gap 1, opp_overlap 1079850 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|