| Internal ID | 18095761 | Source Database | TransTermHP TERM 50 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 50
|
| Sequence |
GGCGCGGTCCGCCGCCGGGCCGCGCC Look for more occurrences |
| Start | 297031 |
| End | 297056 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWH036 adTyH-supercont1.5, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCGCTGAAGCCGAG(5' tail) GGCGCGGTCCG(5' stem) CCGC(loop) CGGGCCGCGCC(3' stem) GTTTCCCCCCGTCCT(3' tail). Confidence: 90. overlap 297030 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|