Internal ID | 18094416 | Source Database | TransTermHP TERM 57 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 57
|
Sequence |
GAGGCCACCCTTGGGTGGCCTC Look for more occurrences |
Start | 166480 |
End | 166501 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BWH035 adTzL-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CATCCCGCCATGAAA(5' tail) GAGGCCACC(5' stem) CAAG(loop) GGTGGCCTC(3' stem) TTCGTTCCGCCGCGG(3' tail). Confidence: 95. opp_overlap 166480 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|