Internal ID | 18084933 | Source Database | TransTermHP TERM 20 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 20
|
Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
Start | 65419 |
End | 65443 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 3577 adTvG-supercont1.25, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTGCGATGGAACGAA(5' tail) GAACCCCGGC(5' stem) CATGA(loop) GCCGGGGTTC(3' stem) TTCGTTCCTGATTGC(3' tail). Confidence: 100. opp_overlap 65419 65415 65422, overlap 65415 65411 65422 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|