| Internal ID | 18082812 | Source Database | TransTermHP TERM 24 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 24
|
| Sequence |
GACCTCGCCGAGGCATCGGCGGGGTC Look for more occurrences |
| Start | 58289 |
| End | 58314 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 3575 adTyh-supercont1.18, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCTCTTTCGGAGAAA(5' tail) GACCCCGCCGA(5' stem) TGCC(loop) TCGGCGAGGTC(3' stem) TTCGCGTCTCGACTC(3' tail). Confidence: 100. opp_overlap 58291 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|