Internal ID | 18080650 | Source Database | TransTermHP TERM 31 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 31
|
Sequence |
GCCCCGCCGGTCGATTGGCGGGGC Look for more occurrences |
Start | 189037 |
End | 189060 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 3573 adTvP-supercont1.9, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCAGACAAAAAAAA(5' tail) GCCCCGCCAA(5' stem) TCGA(loop) CCGGCGGGGC(3' stem) TTTCCCTAAAGCGTG(3' tail). Confidence: 100. opp_overlap 189037 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|