Internal ID | 18078031 | Source Database | TransTermHP TERM 26 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 26
|
Sequence |
CGCGCGGCCCGTGGGCCGCGTG Look for more occurrences |
Start | 93920 |
End | 93941 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PS75 adTyT-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTGTCCCGGAAAAAA(5' tail) CACGCGGCC(5' stem) CACG(loop) GGCCGCGCG(3' stem) ACGGAAGCTTCAGAA(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|