| Internal ID | 18076976 | Source Database | TransTermHP TERM 17 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 17
|
| Sequence |
GCTGCCGGCCACAGGGCCGGCGGC Look for more occurrences |
| Start | 87093 |
| End | 87116 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWH060 adTvY-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCCCGAATGCTTCC(5' tail) GCTGCCGGCC(5' stem) ACAG(loop) GGCCGGCGGC(3' stem) TTCTCACTGACTAGA(3' tail). Confidence: 93. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|