| Internal ID | 18061735 | Source Database | TransTermHP TERM 88 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 88
|
| Sequence |
GCGCCAGGCTGTCGCCTGGCGG Look for more occurrences |
| Start | 296639 |
| End | 296660 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain JMM contig051, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AATATACGAGAAAAA(5' tail) CCGCCAGGC(5' stem) GACA(loop) GCCTGGCGC(3' stem) CTCACATCTGTTGCA(3' tail). Confidence: 100. overlap 296640 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|