Internal ID | 18048989 | Source Database | TransTermHP TERM 1372 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1372
|
Sequence |
AAGCCCCGCGTATGCGGGGCTA Look for more occurrences |
Start | 6170770 |
End | 6170791 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. Eur1 9.41 CD10DRAFT_unitig_0_quiver.2_C, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGTTAAAGCAAAAA(5' tail) AAGCCCCGC(5' stem) GTAT(loop) GCGGGGCTA(3' stem) TTTTTTAGTACATGT(3' tail). Confidence: 100. opp_overlap 6170772, overlap 6170772 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|