| Internal ID | 18046606 | Source Database | TransTermHP TERM 49 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 49
|
| Sequence |
GGCCCTGCATATGCAGGGCC Look for more occurrences |
| Start | 342095 |
| End | 342114 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. PH1b Contig11, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTTATGAATGTAAAA(5' tail) GGCCCTGC(5' stem) ATAT(loop) GCAGGGCC(3' stem) TTTTTCAGGTTGCGG(3' tail). Confidence: 100. opp_overlap 342095 342088 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|