| Internal ID | 18045488 | Source Database | TransTermHP TERM 8 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 8
|
| Sequence |
GGGCCTTGGCAACAAGGCCC Look for more occurrences |
| Start | 32901 |
| End | 32920 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. RIT357 contigs25, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCTTCTGATCCAACG(5' tail) GGGCCTTG(5' stem) GCAA(loop) CAAGGCCC(3' stem) TTTTTTATTCCAGTG(3' tail). Confidence: 100. opp_overlap 32899 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|