| Internal ID | 18045300 | Source Database | TransTermHP TERM 10 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 10
|
| Sequence |
CCCCATGATCACTCATGGGG Look for more occurrences |
| Start | 67713 |
| End | 67732 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. RIT357 contigs17, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCTGTAACGAAAAAA(5' tail) CCCCATGA(5' stem) GTGA(loop) TCATGGGG(3' stem) TTTTTCATTTCCAGC(3' tail). Confidence: 100. opp_overlap 67713 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|