| Internal ID | 18030145 | Source Database | TransTermHP TERM 55 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 55
|
| Sequence |
GGGTTCCGGCGCCAGCCGGAACCC Look for more occurrences |
| Start | 344928 |
| End | 344951 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa E2 genomic scaffold adgft-supercont1.2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGATCCTGGCCCAG(5' tail) GGGTTCCGGC(5' stem) GCCA(loop) GCCGGAACCC(3' stem) TTTTCCATCCGACAC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|