| Internal ID | 17925321 | Source Database | TransTermHP TERM 52 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 52
|
| Sequence |
CGCCCGGCCTTTTGGCCGGGCG Look for more occurrences |
| Start | 228931 |
| End | 228952 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. GM41(2012) ctg3, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATTGCCTGAGAAAAG(5' tail) CGCCCGGCC(5' stem) TTTT(loop) GGCCGGGCG(3' stem) TTTTTGTTTGTGGTT(3' tail). Confidence: 100. opp_overlap 228931 228930 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|