| Internal ID | 17923205 | Source Database | TransTermHP TERM 168 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 168
|
| Sequence |
CGCCTGGACGTGAACCGTCCGGGCG Look for more occurrences |
| Start | 915360 |
| End | 915384 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri KOS6 scaffold1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATTCAGGAAATAAAA(5' tail) CGCCCGGACG(5' stem) GTTCA(loop) CGTCCAGGCG(3' stem) TTGGGTTGCCAGAGG(3' tail). Confidence: 100. opp_overlap 915360 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|