| Internal ID | 17921473 | Source Database | TransTermHP TERM 1217 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1217
|
| Sequence |
GCCACACCGTTAGGGTGTGGC Look for more occurrences |
| Start | 3581179 |
| End | 3581199 |
| Strand | + |
| Genomic Context | Located within gene [HMPREF1487_07689] |
| Replicon | Pseudomonas sp. HPB0071 genomic scaffold aczIi-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTGTAACGCTCGAAA(5' tail) GCCACACC(5' stem) GTTAG(loop) GGTGTGGC(3' stem) TTTTTTATATTTGCT(3' tail). Confidence: 100. opp_overlap 3581179 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|