Internal ID | 17921034 | Source Database | TransTermHP TERM 636 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 636
|
Sequence |
TTTCGGCCAGGTCTCCTGGCCGAAA Look for more occurrences |
Start | 1895133 |
End | 1895157 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. HPB0071 genomic scaffold aczIi-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TAGTACGGTTAGCCT(5' tail) TTTCGGCCAGG(5' stem) TCT(loop) CCTGGCCGAAA(3' stem) TTGTTTTCGCAACAA(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|