Internal ID | 17919684 | Source Database | TransTermHP TERM 158 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 158
|
Sequence |
CCCGCGTACCCGCAAGGGACGCGGG Look for more occurrences |
Start | 841806 |
End | 841830 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. P179 genomic scaffold acBRO-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGGGCATGAAAAAA(5' tail) CCCGCGT-CCC(5' stem) TTGC(loop) GGGTACGCGGG(3' stem) CCTCTGCCTCGACGC(3' tail). Confidence: 100. gap 1, opp_overlap 841764 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|