| Internal ID | 17915925 | Source Database | TransTermHP TERM 125 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 125
|
| Sequence |
CCCCTTGTTTGTAGGAAAACAAGGGG Look for more occurrences |
| Start | 475196 |
| End | 475221 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. VLB120, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TATGAGGTCGAAAAA(5' tail) CCCCTTGTTT(5' stem) GTAGGA(loop) AAACAAGGGG(3' stem) TTTTGTACGATAAAT(3' tail). Confidence: 91. opp_overlap 475184 475196 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|