| Internal ID | 17914622 | Source Database | TransTermHP TERM 20 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 20
|
| Sequence |
CGCCGCTCAATTTGAGCGGCG Look for more occurrences |
| Start | 181261 |
| End | 181281 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. 2-92(2010) strain 2-92 scaffold5.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCCATTAACTAACGG(5' tail) CGCCGCTCA(5' stem) ATT(loop) TGAGCGGCG(3' stem) TTAGTGCTATTTAAT(3' tail). Confidence: 90. opp_overlap 181259 181258, overlap 181255 181251 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|