| Internal ID | 17911548 | Source Database | TransTermHP TERM 394 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 394
|
| Sequence |
CCCGCGTACCCGCAAGGGACGCGGG Look for more occurrences |
| Start | 1597985 |
| End | 1598009 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA003 genomic scaffold adggi-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGTCGAGGCAGAGG(5' tail) CCCGCGTACCC(5' stem) GCAA(loop) GGG-ACGCGGG(3' stem) TTTTTTCATGCCCGG(3' tail). Confidence: 100. gap 1, opp_overlap 1598004 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|