Internal ID | 17910998 | Source Database | TransTermHP TERM 23 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 23
|
Sequence |
GGCGAAGCCATCCGGCTTCGCC Look for more occurrences |
Start | 130564 |
End | 130585 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BWHPSA007 genomic scaffold adgeP-supercont1.2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCAGAAACGAAAAA(5' tail) GGCGAAGCC(5' stem) GGAT(loop) GGCTTCGCC(3' stem) TTTTTTTCTCCACGC(3' tail). Confidence: 100. opp_overlap 130564 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|