| Internal ID | 17908061 | Source Database | TransTermHP TERM 224 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 224
|
| Sequence |
GAACGCCGGCTATCGCCGGCGTTC Look for more occurrences |
| Start | 788523 |
| End | 788546 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa C20 genomic scaffold adgfy-supercont1.2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGCTAGACGCAG(5' tail) GAACGCCGGC(5' stem) TATC(loop) GCCGGCGTTC(3' stem) TTGTTTGCGCGTTCC(3' tail). Confidence: 95. opp_overlap 788526, overlap 788520 788526 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|