| Internal ID | 17907083 | Source Database | TransTermHP TERM 3 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 3
|
| Sequence |
GACCCGGCACTTTGCCGGGTC Look for more occurrences |
| Start | 12465 |
| End | 12485 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. URMO17WK12:I11 H041DRAFT_scaffold00016.16_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTAATCACGGTTATT(5' tail) GACCCGGCA(5' stem) CTT(loop) TGCCGGGTC(3' stem) TTTTTTTGCCTGGCT(3' tail). Confidence: 100. opp_overlap 12457, overlap 12478 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|