| Internal ID | 17905183 | Source Database | TransTermHP TERM 275 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 275
|
| Sequence |
CAAAGCCCGCGCGATGCGGGCTTTG Look for more occurrences |
| Start | 962392 |
| End | 962416 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas chlororaphis O6 chromosome, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AAGTCGTACAAACAA(5' tail) CAAAGCCCGCA(5' stem) TCG(loop) CGCGGGCTTTG(3' stem) TCGTTTTTACTGGCC(3' tail). Confidence: 100. opp_overlap 962389 962392, overlap 962389 962396 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|