Internal ID | 17905179 | Source Database | TransTermHP TERM 271 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 271
|
Sequence |
CGCCCCGACTGGTTCGGGGCG Look for more occurrences |
Start | 962183 |
End | 962203 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas chlororaphis O6 chromosome, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCTGAACAAGCAAA(5' tail) CGCCCCGA(5' stem) CTGGT(loop) TCGGGGCG(3' stem) TTTTGCTATCTGCCG(3' tail). Confidence: 100. opp_overlap 962178 962183, overlap 962178 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|