| Internal ID | 17904845 | Source Database | TransTermHP TERM 123 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 123
|
| Sequence |
GGCCCCGCCAGTGATCTGGCGGGGCC Look for more occurrences |
| Start | 357494 |
| End | 357519 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas umsongensis 20MFCvi1.1 D470DRAFT_scaffold00001.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GTCGCCCATGAAAAA(5' tail) GGCCCCGCCAG(5' stem) ATCA(loop) CTGGCGGGGCC(3' stem) TTTTTTGTTGCATCG(3' tail). Confidence: 100. opp_overlap 357494 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|