| Internal ID | 17903591 | Source Database | TransTermHP TERM 22 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 22
|
| Sequence |
CGCCCGGCTCATTGCCGGGCG Look for more occurrences |
| Start | 56340 |
| End | 56360 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. CF149 soap_scaffs_149.Contig27, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCCTGAACTAAAAA(5' tail) CGCCCGGC(5' stem) TCATT(loop) GCCGGGCG(3' stem) TTTTGGTTTTCAGGC(3' tail). Confidence: 100. opp_overlap 56340, overlap 56335 56326 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|