| Internal ID | 17901142 | Source Database | TransTermHP TERM 11 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 11
|
| Sequence |
GGCTGGCGCAGTGGCCAGCC Look for more occurrences |
| Start | 20915 |
| End | 20934 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri NF13 contig00054, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGAGTGACGCGAAAG(5' tail) GGCTGGC(5' stem) GCAGTG(loop) GCCAGCC(3' stem) TTTTTCATTCGGCGT(3' tail). Confidence: 95. opp_overlap 20914 20915 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|