| Internal ID | 17897536 | Source Database | TransTermHP TERM 26 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 26
|
| Sequence |
GGGAGCCCTTAGCGGCTCCC Look for more occurrences |
| Start | 138643 |
| End | 138662 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. URHB0015 N526DRAFT_scaffold00016.16_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCGGACAGAAAAAA(5' tail) GGGAGCC(5' stem) GCTAAG(loop) GGCTCCC(3' stem) GTCTTTTCACTTCGC(3' tail). Confidence: 100. opp_overlap 138642 138640 138643 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|