| Internal ID | 17895270 | Source Database | TransTermHP TERM 1581 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1581
|
| Sequence |
CCGCCCGGGCATTGCCCGGGCGG Look for more occurrences |
| Start | 5842320 |
| End | 5842342 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas monteilii SB3078, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCCCAGTAAGAAAA(5' tail) CCGCCCGGGC(5' stem) AAT(loop) GCCCGGGCGG(3' stem) TTTTTTTTCGCCTGG(3' tail). Confidence: 100. opp_overlap 5842320, overlap 5842315 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|