| Internal ID | 17894032 | Source Database | TransTermHP TERM 1228 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1228
|
| Sequence |
CGGGGCGCATCATGCGCCCCG Look for more occurrences |
| Start | 4705489 |
| End | 4705509 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas monteilii SB3101, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTCTTTCCACCTGAA(5' tail) CGGGGCGCA(5' stem) TCA(loop) TGCGCCCCG(3' stem) TTTCATTTATATGCC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|