Internal ID | 17893737 | Source Database | TransTermHP TERM 754 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 754
|
Sequence |
CGGCCCGGAACGCTTTCCGGGCCG Look for more occurrences |
Start | 3068577 |
End | 3068600 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas monteilii SB3101, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AACTTTAAATGAAAA(5' tail) CGGCCCGGAA(5' stem) AGCG(loop) TTCCGGGCCG(3' stem) TTTACAGGGTGTTGC(3' tail). Confidence: 100. opp_overlap 3068577, overlap 3068571 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|