Internal ID | 17891741 | Source Database | TransTermHP TERM 697 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 697
|
Sequence |
CCCCATGATCGCTCATGGGG Look for more occurrences |
Start | 3397540 |
End | 3397559 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. TKP, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCGGAAATGAAAAA(5' tail) CCCCATGA(5' stem) GCGA(loop) TCATGGGG(3' stem) TTTTTTCGTTTACAG(3' tail). Confidence: 100. opp_overlap 3397540 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|