Internal ID | 17891343 | Source Database | TransTermHP TERM 144 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 144
|
Sequence |
GGCCCGCCTCCTTCGGATGGCGGGCC Look for more occurrences |
Start | 602903 |
End | 602928 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. TKP, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGTTGAGTTGAGAAA(5' tail) GGCCCGCC-TCC(5' stem) TTC(loop) GGATGGCGGGCC(3' stem) TTTTTTTGGCCTGCG(3' tail). Confidence: 100. gap 1, opp_overlap 602903 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|