| Internal ID | 17890696 | Source Database | TransTermHP TERM 834 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 834
|
| Sequence |
CGGCGCATCCCCAACGGGATGCGCCG Look for more occurrences |
| Start | 3409400 |
| End | 3409425 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa SCV20265, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGCCGATGTGAAAA(5' tail) CGGCGCATCCC(5' stem) GTTG(loop) GGGATGCGCCG(3' stem) TACGCTTCAGCGGTT(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|