Internal ID | 17889461 | Source Database | TransTermHP TERM 458 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 458
|
Sequence |
GCCCTCGGCACATGCCGGGGGC Look for more occurrences |
Start | 1965573 |
End | 1965594 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa MTB-1, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCGATAACGAAAAA(5' tail) GCCCCCGGC(5' stem) ATGT(loop) GCCGAGGGC(3' stem) TTTGAATTTGGCTCC(3' tail). Confidence: 100. opp_overlap 1965573 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|