Internal ID | 17888879 | Source Database | TransTermHP TERM 202 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 202
|
Sequence |
CAAGCCCCGCAATTGGCGGGGCTTCG Look for more occurrences |
Start | 879885 |
End | 879910 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa 62 genomic scaffold adgfr-supercont1.2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TGGCCCCCGGAAAAA(5' tail) CGAAGCCCCGC(5' stem) CAATT(loop) GCGGGGCTT-G(3' stem) CTTGCGGTGTGGGCG(3' tail). Confidence: 95. gap 1, opp_overlap 879889, overlap 879889 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|