| Internal ID | 17877657 | Source Database | TransTermHP TERM 115 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 115
|
| Sequence |
GGCCCCGACACACTCCGGGCC Look for more occurrences |
| Start | 434965 |
| End | 434985 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa 19660 genomic scaffold adgew-supercont1.5, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGCCTCGTGCTCAT(5' tail) GGCCCCGA(5' stem) CACAC(loop) TCCGGGCC(3' stem) TTTTTATCCACAGGA(3' tail). Confidence: 90. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|