Internal ID | 17877511 | Source Database | TransTermHP TERM 92 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 92
|
Sequence |
CCTCGGCCTGGGCGCAGGCCGAGG Look for more occurrences |
Start | 471000 |
End | 471023 |
Strand | + |
Genomic Context | Located within gene [Q010_05192] |
Replicon | Pseudomonas aeruginosa 19660 genomic scaffold adgew-supercont1.4, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGTAGGCCAGCGGCT(5' tail) CCTCGGCCTG(5' stem) GGCG(loop) CAGGCCGAGG(3' stem) TTTCCAGTTGCAGGG(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|