| Internal ID | 17875420 | Source Database | TransTermHP TERM 418 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 418
|
| Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
| Start | 1999161 |
| End | 1999185 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa S35004 genomic scaffold adgfR-supercont1.2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGATGGAACGAA(5' tail) GAACCCCGGC(5' stem) CATGA(loop) GCCGGGGTTC(3' stem) TTCGTTACGGATTGC(3' tail). Confidence: 91. opp_overlap 1999161 1999157 1999164, overlap 1999164 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|