Internal ID | 17873529 | Source Database | TransTermHP TERM 143 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 143
|
Sequence |
CGGGGCGGCTATAATCGCCGCCCCG Look for more occurrences |
Start | 535111 |
End | 535135 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BWHPSA001 genomic scaffold adges-supercont1.3, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCTTTCCGATGCCTG(5' tail) CGGGGCGGCTA(5' stem) TAA(loop) TCGCCGCCCCG(3' stem) TTTTCCCGCTGCCGC(3' tail). Confidence: 100. overlap 535082 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|