| Internal ID | 17870591 | Source Database | TransTermHP TERM 932 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 932
|
| Sequence |
CGCCGGGCTGATGCCCGGCG Look for more occurrences |
| Start | 4006460 |
| End | 4006479 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA005 genomic scaffold adgfj-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGGCGGAAACGAAAA(5' tail) CGCCGGGC(5' stem) TGAT(loop) GCCCGGCG(3' stem) TTTTTCATTGCGCGC(3' tail). Confidence: 100. opp_overlap 4006460 4006455 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|