| Internal ID | 17868732 | Source Database | TransTermHP TERM 770 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 770
|
| Sequence |
GGCTCACCTCCGGGTGGGCC Look for more occurrences |
| Start | 3257673 |
| End | 3257692 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA007 genomic scaffold adgeP-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGAATACGACGAAAA(5' tail) GGCTCACC(5' stem) TCCG(loop) GGTGGGCC(3' stem) TTTTTGCTTTCCGCC(3' tail). Confidence: 100. opp_overlap 3257673 3257667, overlap 3257667 3257666 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|