| Internal ID | 17865178 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
GAAGCCCCGCCATAGCGGGGCTTC Look for more occurrences |
| Start | 6946 |
| End | 6969 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA011 genomic scaffold adgfg-supercont1.4, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCGCGTGAAAACAA(5' tail) GAAGCCCCGC(5' stem) TATG(loop) GCGGGGCTTC(3' stem) TTTTATCGAATCGGC(3' tail). Confidence: 100. opp_overlap 6946, overlap 6949 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|