| Internal ID | 17863064 | Source Database | TransTermHP TERM 424 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 424
|
| Sequence |
GGCGCGCCGGTCGAAACCGGCGCGCC Look for more occurrences |
| Start | 1861725 |
| End | 1861750 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA013 genomic scaffold adggn-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGCGAAATGAAAAA(5' tail) GGCGCGCCGGT(5' stem) CGAA(loop) ACCGGCGCGCC(3' stem) TTTTTCGTTCTGGTC(3' tail). Confidence: 100. opp_overlap 1861725 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|