Internal ID | 17862446 |
Source Database | TransTermHP TERM 989 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 989
|
Sequence |
CGCCGACCCTAGGGTCGGCG Look for more occurrences |
Start | 4322400 |
End | 4322419 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa BWHPSA014 genomic scaffold adgeT-supercont1.1, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGAGGATAAAAAAA(5' tail) CGCCGACC(5' stem) CTAG(loop) GGTCGGCG(3' stem) TTCTTGCATGGCGCG(3' tail). Confidence: 100. opp_overlap 4322400 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|