| Internal ID | 17860900 | Source Database | TransTermHP TERM 115 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 115
|
| Sequence |
GCCCGGCCATCGAGCCGGGC Look for more occurrences |
| Start | 727920 |
| End | 727939 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa BWHPSA015 genomic scaffold adggh-supercont1.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCGCCCACGAAAAA(5' tail) GCCCGGC(5' stem) TCGATG(loop) GCCGGGC(3' stem) TCTTTCGCTGCGGGT(3' tail). Confidence: 100. opp_overlap 727920 727918, overlap 727904 727905 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|